Scientia, Fortitudo et Virtus (Bilgi, Cesaret ve Fazilet)

29 Haziran 2018

GPCR’ler: İlaçların çoğunun hedefi olan bir proteinin çalışma mekanizması

Volume 557 Issue 7705
Nature’da bu hafta…] Bu protein bilim dünyasında "G-protein bağlı reseptörler" olarak bilinmektedir (İngilizce GPCRs olarak kıstırılırlar). 

 Bu reseptörler insanlarda (tabi hayvanlarda da) en geniş ilaç hedefleri olup, transmembran (hücre zarında yerleşik) proteinlerdir. İnsanların kullandığı  ilaçların yaklaşık 700 tanesi (yani tüm ilaçların yaklaşık %35'i) bu reseptörler aracılığı ile etkilerini gösterirler. 

İnsan genomunun yaklaşık % 1'nin koku almaktan görmeye ruhsal durumumuzdan hücre büyüme ve bölünmesine ve de tabi ölmesine kadar birçok işlevi olan bu resptörleri kodladığı bilinmekte ve 1000 farklı çeşidinin olduğu düşünülmektedir. Tüm GPCR'lerin ortak özellikleri ise zar geçişli 7 bölgelerinin olması. İlginç! GPCR
Bu reseptörler hücre dışında uygun moleküller (örn ilaçlar) bağlandığında, yapılarında bir değişiklik olur ve hücre içindeki G proteinleri yardımı ile hücrenin içine (çekirdeğe kadar) sinyal iletirler. Burada G, bir ATP gibi bir enerji molekülü olan GTP'den gelmektedir. Yani, G proteinleri demek GTP ile aktive olan proteinler anlamına gelmektedir. Ancak aşırı sinyallemeyi azaltmak için aktivasyonun zaman zaman durması gerekir. Bu da reseptörün kendisinin fosforile edilmesiyle olur (yani GPCR'a fosfat eklenir ve bu durum onu duyarsızlaştırır). 

Arrestinler G proteinine bağlı reseptörler aracılığı ile sinyal iletimini düzenleyen küçük (memelilerde dört arrestin alt tipi ifade edilir) ama önemli bir protein ailesidir. İlk olarak gözümüzde keşfedildiler. Burada rhodopsin adı verilen ışığa duyarlı bir GPCR'ye bağlanırlar ve onu inaktive edereler. Günümüzde artık GPCR sinyalinin evrensel olduğunu biliyoruz. Yani tüm canlılarda mevcut. 

Arrestinlerin GPCR'lere bağlanması, reseptörlerin sitoplazmik karboksil ucunun fosforilasyonuna sebep olur ve G protein aracılı sinyal durur. Bu sırada reseptörler zarda oluşan, içeriye doğru girinti yapmış kesecikler (klatrin kesecikleri) yardımı ile hücre içine alınır. Bu reseptörler ya hücrenin midesi gibi görev yapan lizozomlara yönlendirilerek bu organellerde parçalanır ya da geriye dönüştürülerek tekrar hücre zarına taşınırlar ve sinyal sürecini yeniden başlatırlar.

Bu hafta Nature dergisinde rapor edilen iki çalışma, arrestin proteinlerinin G-protein-bağlı reseptörler tarafından aktive edildiği mekanizmaları ortaya koymuş gibi görünüyor. Bu da seçici olarak G-proteinini ya da arrestin sinyalini hedef alan yeni ilaç keşifleri anlamına geliyor.
Kaynak
  • Eichel, K. et al. Nature 557, 381–386 (2018).
  • Latorraca, N. R. et al. Nature 557, 452–456 (2018).

3 Mayıs 2018

Tüm virüslere karşı direnç mi istiyorsun: DNA alfabeni değiştir!

IMG-7203
İki yıl önce, Harvard Üniversitesinde gizli yapılan bir toplantı basına sızdırıldı. Genom yazma projesi (GP-write veya diğer adı ile HGP-write) adı verilen bir proje için yapılan bu toplantıda Harvard ve diğer üniversitelerden bilim insanları "tüm bir insan genomunun yapay olarak sentezi"ni tartıştılar.

Peki bu neye yarayacaktı?

İnsan genomunu (yani 46 kromozomumuzdaki bilgiyi) yeniden yazma mümkün olsa, Alzheimer'den tutun kansere kadar hemen tüm insan hastalıklarına sebep olan bozuk genler düzeltilebilir ve böylece "süper insan" yaratılabilirdi.! Bu teknikle dünyaya gelen "dizayn edilmiş bebekler" her türlü hastalığa dirençli olabileceklerdi.

Peki bu nasıl mümkün olacaktı?

Bilgisayar ekranındaki yazıdan resme nasıl ki herşey "binary kod" dediğimiz sıfır ve birlerden (1111000001010100010 gibi) oluşuyorsa, genomomuz yani DNA da 4 harfle oluşturulmuş şifrelerden oluşuyor. Yani tanrının klavyesinde 4 tuş varmış ve üzerinde (A: adenin, G: guanin, C: sitozin ve T: timin) yazıyormuş. Tanrı, bakteriden, bitkiye, insana, file kısaca tüm canlıları aynı genetik kodla yazmış... Fakat, bunu yaparken yer yer "typo" hataları, yani "yazım hataları" da yapmış. Dolayısı ile, genlerimizdeki bu küçük yazılım hataları bizi bir ton hastalığa da yatkın hale getirmiş (kanser, şeker hastalığı, Alzheimer, Parkinson, kalp-damar hastalıkları,viral ve bakteriyel enfeksiyonlar, say sayabildiğin kadar...).

İnsan ve tabi tüm canlılarda DNA'daki genetik şifre RNA üzerinden kodlanıyor. RNA'lar DNA'nın tersine oldukça farklı çeşitte bulunuyor. Kimisi protein sentezine ön ayak oluyor ki, bunlara kodlama yapan RNA'lar (mRNAlar) deniyor, kimisi de diğer yapısal (örn. ribozomların yapısına giren rRNA'lar), işlevsel (örn. amino asitleri kendilerine has enzimlerle birlikte taşıyarak ribozoma getiren tRNA'lar) ve henüz yeni yeni keşfettiğimiz ve dolayısı ile şlevlerini tam bilmediğimiz RNA'lar (miRNA'lar, siRNA'lar, halkasal RNA'lar, lncRNA'lar, vs..).
RNA'ların çeşitleri ve muhtemel işlevleri konusundaki bir yazım: RNA: Önemsiz bir şey mi? Her şey mi?
Proteinlere deşifre olan RNA'lar (yani mRNA'lar) üzerinde 3 harflik diziler olan "kodonlar", amino asitlere tercüme oluyor. Proteinler 20 çeşit amino asitten oluşuyor. Dolayısı ile her bir amino asit için en az 1 adet kodon olmak zorunda. Ancak, DNA ve RNA 4 harften oluştuğundan, 64 adet potansiyel üçlü kodon var (4x4x4). Dolayısı ile bazı amino asitler için birden fazla kodon var. Ancak, bu kodonların biri "esas" diğerleri ise "harcanabilir" ya da "gereksiz" veya "yedek" kodonlar.  Birçok virüs bu "yedek" kodonları hedef alarak bizi hastalandırıyor. Hastalıklarımızın çoğu da bu ikincil derecede önemli yedek kodonlarda olan değişiklikler (mutasyonlar) sonucu ortaya çıkıyor.

Başlıktaki konu, yani virüslere karşı bağışık (dirençli) olmak için, bilim insanları "redundant" dedikleri bu "yedek" kodonları "esas" kodonlara çevirecek gen düzeltmeleri yapmak istiyor. Böylece, DNA düzeyinde yapılan yapay dizi değişikliği (ya da yeniden sentez) ile sadece "esas" kodonlar kullanılacak. Bunun sonucu, vücuda (yani hücreye) girip asılları yanında "yedek" kodonları kullanarak kendi proteinlerini üretmeye çalışacak olan virüsler kendi kendilerini çoğaltamaz.

Bu projenin temeli Harvard Üniversitesi, Tıp Fakültesinden George Church'ın laboratuvarındaki çalışmalara dayanıyor. Church ve arkadaşları, yaygın bir bakteri olan Escherichia coli genomunda bir amino asiti kodlayan 321 "yedek" kodonu "esas" kodonla değiştirdiğinde, bakterinin  bakteriyofaj T7 virüsüne karşı dirençli hale geldiğini gösterdi. 
Aynı grup, 2016 yılında daha da ileri giderek 7 amino asite ait tüm "yedek" kodonları (62,214 adet) genomdan sildi. Sonuç: birçok virüse dirençli süper E. coli. Yapılan hesaplara göre, insan genomunda bulunan yaklaşık 20000 gende bu şekildeki yaklaşık 400,000 "yedek" kodunu asılları ile değiştirirsek insanlar virüslere tamamen dirençli (virüs geçirmez!) hale gelebilirler.


crispr-gene-editingEn başta bahsettiğimiz genomu yapay olarak yeniden sentezlemek gibi meşakkatli bir çabaya girmek yerine, CRISPR-Cas teknolojisi gibi yeni genom düzeltme (edit etme) teknolojileri ile hali hazırdaki genomlar bu şekilde hastalık ve virüslere karşı düzeltilebilir. Çünkü, 10 DNA harfinin sentezi yaklaşık 1 dolara mal olduğundan, bir insanın tüm haploit genomunun sentezi 30 milyon dolara mal olacak. Bir kerede en fazla 200 harf yazabildiğimiz için, yazılan bu parçaların birleşmesi vs. oldukça emek ve zaman isteyen bir durum.
CRISPR-Cas ile ilgili bir yazı için buraya, buraya, burayaburaya ve buraya tıklayınız.
Dolayısı ile bugünlerde bir araya gelen ve yaklaşık 200 bilim insanından oluşan aynı grup, baştaki tüm genom sentezi projesinin boyutunu ve şeklini küçültmüş görünüyor. Genomu yeniden sentez yerine, tüm genomdaki "yedek" kodonları (400 bin kadar) "asılları" ile değiştirerek virüslere karşı dirençli insan hücresi (ve belki de ileride yumurta ve spermde bunu yaparak birey) oluşturmak. Bunun 10 yıl kadar bir sürede mümkün olacağı hesaplanıyor.
g-church

George Church'la Harvard medical School'daki bir sunumdan sonra... George Church genom dizileme çalışmalarında bir dünya lideri ve İnsan Genom Projesinde öncülerinden. İki metreye yaklaşan boyu ve iri cüssesinin yanında cüce gibi kalıyorum!!!.


Hücreler ayrıca kansere karşı da yeniden kodlanabilir. Genomdaki en kararsız ve yüksek mutasyon oranına sahip iki harf CG'dir (yanyana bulunduklarında). Bu mutasyonlar bazen kanseri tetikler. Birçok amino asit "yedek" kodonu CG içerir. Bu kodonlar asılları ile değiştirilirse, hücreler hala aynı doğru amino asiti kullanır ancak, ancak tümörlerin ortaya çıka olasılığı oldukça azalır.
Değiştirilerek faydalanılan kaynaklar: STAT, JAMA, C&EN, The Atalantic, Science, NatureGP-write website
genome-write
Science Magazine

İleri derecede yeniden yazılmış genomu olan “ultragüvenli” hücrelerin bazı özellikleri (Science'tan).

Konuya yabancı olanlar için başlıktaki konunun anlaşılması için biraz genel bilgiye ne dersiniz?..

DNA oldukça tekdüze yani "monoton" bir molekül. Tek işi üzerinde şifrelenmiş bilgi taşıması. O şifre deşifre edilmedikçe bir işe yaramıyor. Bunu şuna benzetebiliriz:  Elinizde kalın (6 milyar harften oluşan) bir kitap (46 kromozomdaki DNA) var ve kelimeler arasında ne yazık ki boşluk yok. Dolayısı ile bu paragraf şöyle görünecekti:
dnaoldukçatekdüzeyanimonotonbirmolekültekişiüzerindeşifrelenmişbilgitaşımasıoşifredeşifreedilmedikçebirişeyaramıyorbunuşunabenzetebilirizelinizdekalınaltımilyarharftenoluşanirkitapkırkaltıkromozomdakidnavarvekelimelerarasındaneyazıkkiboşlukyokdolayısıilebuparagrafşöylegörünecekti

Bir şey anladınız mı? ben anlamadım! Tek fark, DNA'da 29 harf değil 4 harf kullanılıyor!!!

Dolayısı ile DNA'ya baktığımızda bizde çok da bir fikir oluşturmayan GCCCTTTTTGGGGAAAAATTTTTTTTCCGA harflerini görürüz. Peki bütün bir canlıyı yapan bilgi nasıl oluyor da bu harf dizilerinde saklı? Bilgisayardaki tüm bilgi nasıl ki "bir" ve "sıfır"larda saklı ise, DNA'da da aynı durum var... Bu şifreyi çözecek "programlar" var.

Esasen DNA'daki bilgiyi (kodu) çözen iki program var: çeviri (dekodlama) ve ifade.

Dekodlama ile DNA molekülü, RNA molekülüne çevriliyor. RNA, bir harfi hariç DNA ile aynı harfleri kullanıyor. Her nasılsa, DNA'daki T yerine RNA'da U (urasil) kullanılıyor. Dolayısı ile işlemin adı "yeniden kodlama". Çünkü RNA'lara da bakarsanız genel olarak AGCU harflerinden oluştuğunu görürsünüz.

Dolayısı ile bu harflerin dizilerinin de ne anlama geldiğini bilemezsiniz...
RNA'daki şifre nasıl çözülüyor. Bunu açıklamadan önce şunu söylememiz gerekiyor. Monoton DNA'ya göre RNA'lar oldukça farklı yapı ve işlevlerde bulunabiliyor. Ders kitaplarında esas olarak 3 çeşit RNA'dan (mRNA, rRNA, tRNA) yoğun olarak bahsedilse de, son yıllarda onlarca çeşit RNA (miRNAlar, siRNAlar, lncRNAlar, halkasal RNAlar, vs) keşfedildi ve çoğunun ne işe yaradığı ise tam bir muamma... 

chromosome

Şifre çözmeye dönersek... Bu işi "ribozom" yapıyor. RNA ve proteinlerden oluşan bu yapılar tüm canlıların da ortak yapısı (hücre zarı ve DNA gibi). Ribozomlara bağlanan mRNA'lar burada deşifre edilir ve  yapısal ve işlevsel fonksiyonları olan olan proteinler yapılır. Yani, DNA'daki şifre RNA üzerinden proteinlere deşifre oluyor. Proteinlerde tüm yapısal ve görsel özelliklerimizi (fenotip) belirliyor. Yani genotip (DNA)'ten fenotipe (protein) bir bilgi akışı söz konusu... Tüm bu akışa "genetik kod" deniyor.
chromosome-nucl 

Taramalı elektron mikroskobu ile görselleştirilen insan kromozomları ve çekirdeği.


Genetik kodlama DNA üzerindeki bilgi RNA'ya transfer ediliyor. RNA (mRNA) üzerindeki bilgi 3 harfli kodonlarda saklı ve bu sırrı da ribozom çözüyor. Ribozom, mRNA'ların üzerindeki 3 harfin (kodon) sığacağı özel bir alana sahip. Buraya gelen ve üzerinde özel bir amino asidi taşıyan taşıyıcı RNA'lar (tRNA) üzerindeki 3 harfle (anti-kodon) kodona bağlanır. Enzimatik bir mekanizma ile taşınan bu amino asitler birbirine kovalent bir bağ (peptid bağı) ile bağlanır. Böylece, uzun bir polipetid zinciri yapılır ve bittikten sonra ribozomdan salınarak uygun yapı ve işlevi kazanacak şekilde katlanır.
DNA molekülü ne kadar uzun olursa olsun (örn, en uzun DNA molekülü 1. kromozomumuzda, en kısası da 22. kromozomda bulunmakta), 4 kimyasal molekülden (harf) oluşmakta. Esasen, en küçük kromozom, dolayısı ile en kısa DNA molekülü Y kromozomunda bulunmakta ise de, bu kromozom tüm insan (kadınlarda) veya hayvanlarda bulunmaz. Bu harflere çekirdek maddesi anlamına gelen "nükleotid" ismi verilir ve her birinde birer fosfat grubu, deoksiriboz adı verilen 5 karbonlu bir şeker molekülü ve her birinin kendine has tek (C ve T) veya çift halka (A ve G) içeren bazı bulunur.


DNA, kromozom ve genomlarla ilgili bir yazım: Genler Kaderimiz mi?

29 Nisan 2018

Science ve Nature’da bu hafta…

human_genome
Neden Science ve Nature? Resmin üzerine tıklayın...

Metabolizmayı bozarak otoimmün hastalıkları tedavi etmek

Otoimmün (vücudun kendine karşı bağışıklık geliştirmesi) ve enflamatuar (iltihabi) hastalıklar, bağışıklık hücrelerinin uygun olmayan ve uzun süreli aktivasyonunun neden olduğu durumlardır. İltihabi mediyatörlerin sürekli olarak devam eden üretimi doku hasarına neden olur. 

Dimetil fumarat (DMF) fumarik asitin bir metil esteri olup, bir çeşit otoimmün cilt hastalığı olan psoriasis tedavisinde kullanılmaktadır.  2013 yılında DMF, yine otoimmün bir hastalık olan multipl sklerozun (MS) tedavisi için onaylanmıştır. Bununla birlikte, DMF'nin etki mekanizması bilinmemekte idi.

Bu hafta bilim adamları DMF'nin yararlı etkilerinin, gliseraldehid-3-fosfat dehidrogenaz (GAPDH) enzimini inhibe etmekle ilişkili olduğunu gösterdi. GAPDH, glikoz metabolizmasının ana yolaklarından olan glikolizde merkezi bir enzimdir.

Bu çalışma bize şunu gösteriyor: bağışıklık yanıtlarını modüle etmek için metabolizma hedeflenebilir.
Genom güdümlü kanser tedavisi bir aldatmaca mı?
Kanserin ilerlemiş haline sahip hastalar için seçenekler tükenirken, birçok kanser merkezi şu anda şu umudu sunuyor: Tümörünüzün genomu dizilensin ve doktorlarımız kanserinizin zayıf noktasını hedefleyen bir ilaçla sizi tedavi etsin. 

Ancak, bu verilen sözün abartılı olduğunu söyleyen bilim insanları da var. Geçen hafta, alandaki iki önemli ses, Şikago'daki Amerikan Kanser Araştırmaları Derneği'nin yıllık toplantısında kişiye "özel onkoloji" olarak adlandırılan bir konuda karşı karşıya geldiler. Genom tabanlı kanser tedavileri konusundaki tartışmalar bilim insanlarını da bölmüş durumda.

Bir hastaya maliyeti 1 milyon dolarları bulan bu tür tedavilerin parayı götürdüğü, ancak tama olarak ne getirdiği belli değil.

diagnostics

CRISPR ile yeni nesil teşhisler

Bulaşıcı hastalıkların hızlı ve doğru bir şekilde tanımlanması, klinik bakım ve hastalıkların yayılmasını sınırlamak için elzemdir. Prokaryotların (bakteri ve arkea) CRISPR ve CRISPR ile ilişkili (Cas) proteinlerin aracılık ettiği kalıtsal adaptif bağışıklığa sahip olduğunun keşfi, gen düzenlenmesi başta olmak üzere moleküler biyolojide devrim niteliğinde ilerlemelere yol açmıştır.

Bu hafta araştırmacılar Zika virüsü, Dengue virüsü ve insan papilloma virüsünün (HPV) tespiti, bulaşıcı olmayan enfeksiyon hastalıkları ve  akciğer kanseri hastalarında dolaşımdaki DNA'larda gen mutasyonlarının saptanmasında CRISPR-Cas'ın moleküler teşhis aracı olarak kullanılması konusunda perspektifler sundular.


Henüz yeni olan CRISPR-Cas teknolojisi; meyve-sebze üretimi, içerik zenginleşitirmesi, mikroplara ve yukarıda belirtildiği gibi virüslere karşı mücadele için yakın zamanda kullanılacağı düşünülmektedir. Ancak, hedef dışı değişikliklere sebep olmasından dolayı bu teknoloji ile insanda bazı genetik hastalıkların düzeltilmesi (özellikle tek genle geçen) konusu henüz bilinmeyen bir gelecekte olabilecektir.

7 Nisan 2018

Temel Bilimlerin Önemi: Bir Amerikan Örneği…

Amerika Ulusal Bilim Vakfı (National Science Foundation, NSF) tarafından “Dünyayı Bilim Yolu ile Değiştirmek” raporunun 2. baskısı yeni yayımlandı (LINK).
Amerika taktir edersiniz ki “salak” bir ülke değil. Bir şekilde dünyanın en parlak beyinlerini ve girişimcilerini cezbediyor.
Bu raporu okuyunca Amerika’nın neden bilim ve teknolojinin merkezi olduğunu daha iyi anlayabiliyoruz: merak ve üretim.
Merak onları bilimde bir numara yaparken, üretim onları teknolojide bir numara yapıyor.
Merak; düşünce sınırlarının olmadığı, hiç bir tabu gözetilmeden bir konuyu anlama (ve tabi tartışma) ortamının sağlanması ile daha da uyarılırken, üretim ise bilimsel verilerden yola çıkarak iğneden ipliğe toplumun ihtiyaçlarının karşılanması konusunda yaratıcı uygulamalarla oluyor.
Üreticiliğin olmazsa olmazı tabi sıkı bir “fikri ve sınai haklar” kanunu ve mevzuatının olması. Kimse kimsenin fikrini, zikrini ve tabi ürettiği ürünü kopyalayamıyor. Bu da, yaratıcılık ve girişimciliği getiriyor. Bu nedenledir ki, Amerika her yıl yaratıcı ve çığır açıcı buluşlara verilen Nobel Ödüllerini silip süpürürken, sadece teknolojik olarak ileri olan Güney Kore ve Japonya gibi ülkeler ise nal topluyor.
Her ne ise konumuza dönersek …
Ülkemizde temel bilimler (Fizik, Kimya, Biyoloji) patır patır kapanırken, Amerikan NSF’si bu tür alanlara proje desteğini arttırarak devam ediyor. Proje sahiplerinden hiç de bir ilaç veya alet geliştirmeyi beklemiyor.
Çünkü, NSF biliyor ki, bugünün araştırma ve buluşları yarının ürünlerine bir şekilde dönecektir. Hücreyi bilmeden kanserin nasıl geliştiğini, kanseri bilmeden kanser ilacını geliştiremezsiniz.
Ne yazık ki çoğu ülke yılları bulabilen böyle meşakkatli bir yolu seçeceğine, parası varsa doğrudan o ürünü alma yoluna gidiyor. Bu durum sadece ülkenin ekonomisini değil insan zihnini de zayıflatıyor.
Böylece, bir telefonun veya İnternetin nasıl çalıştığını merak edip benzer sistemleri geliştirecek bireyler yerine, kulağında akıllı telefon, önünde Facebook ekranına mahkum olmuş, entelektüellik ve gözünde hiç bir anlam göremediğin bireyler! Amerika’nın da ekseriyeti böyle olabilir. Hatta en çok evsiz en çok seri katil de bu ülkede olabilir. Ancak, sağladığı ortamla en azından bilim insanı ve girişimcisi tüm toplumu (bazen dünyayı) peşinden sürükler.
İşte size NSF başkanının bu raporda söyledikleri:
NSF’nin yıllık bütçesinin yüzde doksan üçü, çığır açan temel araştırmalara, STEM (yani Fen, Teknoloji, Mühendislik, Matematik) eğitiminine ve STEM işgücünün gelişimine ayrılmaktadır. Bilim ve mühendislik çalışmaları, ABD ekonomisinin güçlü ve rekabetçi kalmasını sağlar.  
Misyonuna sadık kalan NSF, ulusun bilim ve teknolojide önemli bir küresel aktör olarak kalmasını ve sürekli bir keşif ve inovasyonla ön saflarda yer almasını sağlıyor.
France A. Córdova (NSF Direktörü)
NSF’ın misyonunda şunlar yazılıdır: “Bilimin ilerlemesini teşvik etmek; Ulusal sağlık ve refah ilerletmek, milli savunmayı güvenceye almak“.
Rapordan bir başka paragraf:
Temel araştırmalar mümkün olanın sınırlarını zorluyor ve etrafımızdaki dünyayı daha derin bir anlayışa kavramamızı sağlıyor. Ulusal Bilim Vakfı (NSF), tüm bilim ve mühendislik (S & E) alanlarındaki sorulara cevaplar için özenli bir çaba sarf etmektedir.
İşte size sayılarla NSF:


NSF
Rakamlar 2017 aktivitelerine aittir.

NSF’in araştırma ve eğitime ayırdığı %93’lük bütşenin büyük kısmını götüren Biyoloji için NSF raporunda şöyle denilmektedir:
NSF’nin Biyolojik Bilimler Direktörlüğü (BIO) tarafından desteklenen temel araştırmalar, insanların ve diğer hayvanların, bitkilerin ve bir dizi mikroorganizmanın birbirleriyle nasıl e birbirleriyle nasıl etkileştiklerini ve çeşitli çevresel koşullara nasıl tepki verdiklerini ve bunlara nasıl uyum sağladıklarını anlamaya çalışır.
BIO destekli araştırmacılar, Dünya’daki yaşamın nasıl geliştiğini ve çeşitlendiğini belirleyen temel kuralları anlamaya çalışırlar. Biyologların çalışmaları hastalıkların önlenmesi ve tedavi edilmesi, tarım uygulamalarının iyileştirilmesi ve doğal kaynakların korunması için yeni yollara götürür.
Teknoloji ile dönüştürülen biyoloji alanı  “Büyük Veriler” in de dahil edilmesi ile, yeni atılımların eşiğinde durmaktadır. Bu da, Bilim ve Mühendsilik alanlarındaki araştırmacıları meşgul etmektedir. NSFBIO , biyolojik bilimleri ilerletmek için gereken altyapıya, araçlara ve teorilere yatırım yapar ve ABD’nin keşfin ön safında kalmasını sağlar. NSFBIO tarafından finanse edilen araştırmalardan elde edilen sonuçlar insan sağlığını, gıda güvenliğini, biyoçeşitliliğin korunmasını ve daha fazlasını sağlayarak biyolojiyi 21. yüzyılda yenilik için bir motor haline getirmektedir.
Eh. bunun üzerine artık ne söylenebilir… Umarım “parası bol, beyni boş”  ülkelerden biri olmayız!

27 Şubat 2018

Hangi biomedikal çalışma en değerlisi: Bir karşılaştırma! (Which is the MVP of biomedical innovation?)

Amerika’nın bilim ve sağlık alanında önemli bir haber ve yorum sitesi olan STAT’ın biyomedikal alanında öncü çalışmaları ile bilinen araştırma kurumları arasında MVP’yi (yani en değerli oyuncuyu) seçmek için bir anket hazırlamış.

Ankette, benzer işi yapan kurumlardan ikişer tane seçilmiş ve bunlardan hangisinin yaptığı çalışmanın daha önemli olduğu seçmenlere soruluyor. Böylece en son finalistler ve finalist belirlenecek.

Oyum saklı! Bilim haberciliğinde ödül sahibi yazarlar tarafından karar verilen bu 64 kadar çalışma ve aktörleri şöyle… (uzun bir anket ve ne yazık ki İngilizce!):
012345678910111213141516171819202123
Kaynak: STAT

31 Ocak 2018

Türkiye'de Doktora: Sayısal Veriler...

12345678 9101112131415161718


MEZUN DOKTORA ÖĞRENCİLERİNİN AKADEMİK ALANDA, ÜNİVERSİTELERDE VE ENDÜSTRİDE İŞ OLANAKLARINI ARTIRMA ÇALIŞMALARI
(Doktora Öğrencileri İçin İş Marketler - Job Markets)
Türkiye'de üniversiteler ihtiyaçları olan alanlarda akademik ilanları ulusal basında ve kendi web sitelerinde yayınlamakta, başvuruları almakta ve oluşturulan jürilerce uygun görülen öğretim görevlisini bünyelerine katmaktadır. Bu yapının üst ayağı YÖK'te yapılan kadro çalışmalarıdır.

Halbuki sürecin bir başka boyutu özellikle doktorasını yeni bitirmiş, akademiye veya endüstriye katılarak alanında ilerlemek isteyen yüzlerce genç akademisyen adayından üniversitelerimiz haberdar olamamaktadırlar. Bu amaçla özellikle Amerika Birleşik Devletleri'nde ve Avrupa'da genç akademik grubun tanınmasını sağlayan –İş Marketler- tanıtım ve iş marketleri bu alanda yön verici ve destekleyici olmakta ve çok yaygın olarak kullanılmaktadır. Bu tanıtımda doktorasını bitirmiş genç aday bir fotoğrafıyla birlikte kendi özgeçmişini, tez konusunu, danışmanının ve tez hocasının kim olduğunu ve çalışma alanlarını detaylı bir şekilde tanıtmaktadır. Bu tanıtımda özellikle doktorantın araştırma potansiyeli ve araştırma ilgi alanı öne çıkarılmalıdır. Bu tanıtım, akademiye, endüstriye ve de uluslararası görünüme açık olacaktır. Dolayısıyla doktoralarını tamamlamış, akademinin en genç kitlesine ciddi bir görünürlük ve tanınırlık sağlayacaktır.

Yükseköğretim Kurulu 2017 yılından itibaren kendi web sayfasında böyle bir çalışmayı başlatmanın hazırlığındadır. Ayrıca üniversitelerimize kendi web sayfalarında kendi yetiştirdikleri doktora öğrencilerini akademik alanlarına göre tanıtan sayfalar açmalarını önerecektir.

Böylece arzu ettiğimiz özellikle ülkenin Doğu Anadolu, Güneydoğu Anadolu ve İç Anadolu bölgelerinde öğretim üyesi, akademisyen ve araştırmacı bulmakta zorlanan üniversitelerimiz doğrudan bu doktorantlarla görüşebilecek veya kümülatif araştırma gruplarının oluşması sağlanacaktır. Ayrıca sadece ulusal değil uluslararası akademi dünyası da ülkemizde yetişen bu gruba ulaşabilme olanağı elde edecektir.

Web sayfası dışında senede iki kez doktorantların üniversitelerle yüz yüze tanışmasını sağlayacak çeşitli toplantılar düzenlemek de planlarımız arasındadır. Yüz yüze yapılacak toplantılara yurt dışından da birçok dekan ve rektörün katılımını sağlayacağız.
Bu katılımla genç akademisyen adaylarının akademide birlikte çalışmalarının güçlenmesi, iletişimlerinin artması ve uluslararası bağlantılar kurabilmeleri de hedeflerimiz arasındadır.

Kaynak: YÖK, 100/2000 Projesi

100/2000 YÖK Doktora Programları Projesi
Küresel rekabet ortamında ülkelerin pozisyonlarının belirlenmesinde yükseköğretim odaklı süreçlerindeki performanslarının etkisi önemlidir. Bu kapsamda birçok ülkede yükseköğretim odaklı rekabete açık ve özellikle araştırmacı insan kaynağının geliştirilmesine yönelik programlar başlatılmıştır, bunlardan bazıları aşağıdadır:
Almanya Excellence Initiative
Çin Project 985 ve Project 865
Kore Brain Korea 21 programme
Japonya Global 30
Tayvan Top Universities Project
Rusya 5-100 Project

Türkiye'nin 2023 yılı için ekonomide bilimdeki hedefleri kapsamında, yükseköğretim odaklı olarak önüne koyduğu stratejilerin başında:
· Bilgi transferi ekosisteminin oluşturulması ve geliştirilmesi,
· Eğitim ve insan kaynakları sisteminin oluşturulması ve geliştirilmesi, gelmektedir.

Bu konuda özellikle 2011 yılından sonra birçok kurum tarafından çalışmalar başlatılmıştır. Ancak sürecin en önemli girdisini oluşturacak nitelikli insan kaynağının nicel ve nitel kapsamda geliştirilmesine ihtiyaç bulunmaktadır. Mühendislik ve teknolojide doktora alanı olarak seçtiğimiz başlıklar, çalışılacak konuların ekonomik refah için bir üretim getirmesi, ekonomik ve toplumsal faaliyet alanlarına uygulanabilir olması ve uygulandıkları alanlarda üretkenliğin artmasının sağlanabilmesi hedeflenmektedir. Yarının dünyasında iddia sahibi olmanın yolu buradan geçmektedir ve YÖK bunu bir stratejik hedef olarak benimsemiştir. "Kalite güvencesi" kavramı, yükseköğretimin ve onun en önemli görevlerinden biri olan araştırmanın uluslararasılaşmasında aranılan ciddi bir değerdir. YÖK, 100/2000 Projesi sadece mali bir fonlama kaynağı olarak görülmeyecek, aynı zamanda kalite kavramını doktora sürecinin her döneminde takip edecektir. Çünkü, doktora (PhD) uluslararası bir kavramdır. Mobilitenin ve disiplinler arası çalışmanın bu kadar önde olduğu bir dönemde doktora programlarının da uluslararası eğitim değerleriyle yürütülmesi şarttır. 100/2000 Projesi'nin, üniversitelerimizde doktora kariyerini bugünkü olduğundan daha da öne taşıyacağını ümit etmekteyiz. Ülkemiz doktoralı insan kaynağı oranında 1000 kişiye 0.4 doktoralı insan kaynağı düşmektedir. Bu oran Çin'de, 2.2, ABD'de 1.7, Avrupa Birliğinde 1.5, Güney Kore'de 1.4, Kanada'da 1.2, Japonya'da 1.1'dir.

100 / 2000 Programı bu amaca yönelik olarak ülkemizin ihtiyaçları ve gelişim alanları dikkate alınarak uzun ve katılımcı bir yaklaşımla tasarlanmıştır ve geleceğe yönelik etkin bir projedir. Bu program kapsamında ülkemizin öncelikli alanlarına yönelik 100 alanda 2000 doktoralı insan kaynağı yetiştirilecektir. Bu insan kaynaklarının istihdamı ise sadece akademiye yönelik olmayıp, özellikle kamunun ve özel sektörün de gelişimi odaklı süreçlerine de ciddi yararlar sağlayacaktır.

Özetle 100 / 2000'in amacı hedefler doğrultusunda seçtiğimiz belirli alanlarda yetkinleşmektir. Şimdi bu genç ve dinamik nesile bunu tam olarak ifade etmeyi ve sürdürülebilir kalkınmayı önüne hedef koymuş Türkiye'de rol sahibi olabilmeleri için onları yetiştirdiğimizi anlatabilmemiz gerekmektedir. Çünkü Türkiye'nin bu alanlardayetkin bilim adamları olmalıdır.

2023 için çizilen vizyonda "net katma değerini kendi beyin gücüne dayanarak artırabilen" bir Türkiye hedeflenmektedir.

Hangi Alanlarda Verilmektedir?
1. TEMEL BİLİMLER VE MÜHENDİSLİK (Üst Alan)
01.01. Bulut / Nesnelerin İnterneti / Sosyal Ağlar / Büyük Veri (Alan)
01.01.01. Bilgi Güvenliği
01.01.02. Siber Güvenlik
01.01.03. Kriptoloji
01.01.04. Veri Madenciliği ve Veri Depolama
01.01.05. Veri Analitiği
01.01.06. Örüntü Tanıma Analizi
01.01.07. Biyometri ve Mahremiyet
01.01.08. Yüksek Başarımlı Hesaplama
01.02. Havacılık ve Uzay (Alan)
01.02.01. Hava ve Uzay Araçları Tasarımı
01.02.02. İtki Sistemleri
01.02.03. Otonom İnsansız Hava Araçları
01.03. Sağlık ve Moleküler – Hücresel Mühendislik (Alan)
01.03.01. Biyomalzeme ve Doku Mühendisliği
01.03.02. Biyomedikal Ekipmanlar (Tıbbi Cihazlar)
01.03.03 . İnsan Beyni ve Nörobilim
01.03.04. Nörogenetik
01.03.05. Gıda-Metabolizma Etkileşimi
01.03.06. Nanobiyoteknolojik Güdümlü İlaçlar
01.03.07. Biyosensörler
01.03.08. Biyoenformatik
01.03.09. Aşı Çalışmaları
01.03.10. Translasyonel Tıp
01.04. Gıda Teknolojileri (Alan)
01.04.01. Organik Tarım
01.04.02. Gıda Biyoteknolojisi
01.04.03. Gıda Güvenliği ve Gıda Güvencesi
01.05. Ulaştırma Akıllı Ulaşım Sistemleri (Alan)
01.05.01. Sürdürülebilir ve Akıllı Ulaşım
01.06. Enerji Teknolojileri (Alan)
01.06.01. Hidrojen ve Yakıt pilleri
01.06.02. Güç ve Depolama Teknolojileri
01.06.03. Enerji Depolama ve Enerji Malzemeleri
01.06.04. Yenilenebilir Enerji Kaynakları / Teknolojileri (Güneş Enerjisi, Rüzgar Enerjisi, Jeotermal, Hidrogüç)
01.06.05. Nükleer Enerji
01.07. Robotlar ve Akıllı Sistemler (Alan)
01.07.01. Robot Teknolojileri
01.07.02. İnsan- Bilgisayar Etkileşimi
01.07.03. Yapay Zeka
01.08. Malzeme Bilimi ve Mühendisliği (Alan)
01.08.01. Enerjik Malzemeler Teknolojileri
01.08.02. Yeni 3B Eklemeli Üretim
01.08.03. Akıllı Malzemeler
01.08.04. Biyobenzetim
01.08.05. Sıvı Arıtma Teknolojileri
01.08.06. Çalışanı Koruyucu Malzemeler (PPE)
01.08.07 . Fotonik
01.09. Mikro/Nano/Opto-elektronik ve Yarı İletken Teknolojileri (Alan)
01.09.01. Mikro ve Nanoteknoloji
01.09.02. Sensör Teknolojileri
01.10. Savunma Teknolojileri (Alan)
01.10.01. Savunma Sistemleri Entegrasyonu ve Sistem Mühendisliği
01.10.02. Savunma Bilişimi, Modelleme ve Simulasyon
01.11. Sürdürebilir Çevre Yönetimi Teknolojileri, Ekosistemler ve Sürdürülebilir Yapılı Çevre (Alan)
01.11.01. Sürdürülebilir ve Akıllı Kentler
01.11.02. Sürdürülebilir ve Akıllı Yerleşke
01.11.03. Sürdürülebilir Yapı Malzemeleri ve Teknolojileri
2. SAĞLIK (Üst Alan)
02.01. Tıp - Temel Bilimler (Alan)
02.01.01 . Moleküler Patoloji
02.01.02. Moleküler Farmakoloji ve İlaç Araştırmaları
02.01.03. Tümör İmmunolojisi
02.01.04. Moleküler Onkoloji
02.01.05. Gen Tedavisi ve Genom Çalışmaları
02.01.06. Kanser Epidemiyoloji
02.01.07. Doğal ve Bitkisel Ürünler, Kozmetik Ürünler
02.01.08. Farmakoekonomi ve Hasta Güvenliği
02.01.09. Farmasötik Biyoteknoloji ve İlaç Tasarımı
02.01.10. Fizyopatoloji
02.02. Tıp - Klinik Bilimler (Alan)
02.02.01. Hastane Enfeksiyonları
02.02.02. İnme (Stroke): Nörolojik Motor Rehabilitasyon
02.02.03. Davranış Bilimleri ve Yapay Zeka
02.02.04. Nörofizyoloji
02.02.05. Radyofarmasi ve Nükleer Tıp
02.02.06. Odyoloji ve Konuşma Bozuklukları
02.02.07. Klinik Beslenme
02.02.08. Moleküler ve Hücresel Gastroenteroloji
02.02.09. Metabolizma ve Kronik Hastalıklar (Obezite, Diyabet ve Ateroskleroz)
02.02.10. Otoinflamatuar Hastalıklar
02.02.11. Afet Tıbbı
02.02.12. KBRN Çalışmaları
02.03. Hemşirelik (Alan)
02.03.01. Psikiyatri Hemşireliği
02.03.02. Diyabet ve Podoloji Hemşireliği
02.03.03. Geriatri Hemşireliği
02.03.04. Acil Hemşireliği
02.03.05. Yoğun Bakım Hemşireliği
03.SOSYAL BİLİMLER (Üst Alan)
03.01. Hukuk (Alan)
03.01.01. Kamu Hukuku
03.01.02. Özel Hukuk
03.02. Sosyal Bilimler (Alan)
03.02.01. Katılım Bankacılığı
03.02.02. Kentsel Dönüşüm Çalışmaları
03.02.03. Yaşlılık Çalışmaları
03.02.04. Yoksulluk Çalışmaları
03.02.05. Göç Çalışmaları
03.02.06. Uluslararası Güvenlik ve Terör
03.02.07. Sosyal Medya Çalışmaları
03.02.08. Psikoloji
03.02.09. Felsefe
03.02.10. Mantık
03.02.11. Eski Türk Dili
03.02.12. Okul Öncesi Eğitim
03.02.13. Özel Eğitim (Yetenekli, Engelli vb)
03.03. Filoloji (Alan)
03.03.01. Ermenice
03.03.02. İbranice
03.03.03. Çince
03.03.04. Rusça
03.04. Yönetim Bilimleri (Alan)
03.04.01. Bilim ve Teknoloji Politikaları
03.04.02. Tedarik Zinciri Yönetimi
03.04.03. Ar-Ge Yönetimi
04. MİMARLIK VE TASARIM (Üst Alan)
04.01.01. Mimarlık
04.01.02. Endüstriyel Ürünler Tasarımı
04.01.03. Şehir ve Bölge Planlama
04.01.04. Restorasyon
YÜKSEKÖĞRETİM KURULU TARAFINDAN DOKTORA PROGRAMLARINA KAYITLI ÖĞRENCİLERE VERİLECEK BURSLARA İLİŞKİN USUL VE ESASLAR

19 Ocak 2018

Çok az üniversitenin başardığı: Akademik Mükemmeliyet Merkezi ve Dünya Çapında Olmak!

ranking-univBirçok üniversite için, “dünya çapında olmak” statüsü ya önemli bir başarı ya da kalıcı bir hedeftir. Birinci sınıf üniversite herkes için farklı şeyler olabilir: yenilik merkezi, ekonomik bir motor ve bölgesel veya ulusal prestij ve gurur noktası. Bu nedenle, dünya standartlarında bir başarıdan ne kastedildiğinin anlaşılması kolaydır.
Her ülke birinci sınıf bir üniversite veya üniversiteler ister. Birçok ülke onlarsız  olamayacağını düşünür. Sorun şu ki, dünya çapında bir üniversitenin ne olduğunu kimse bilmiyor ve dünya çapında olmak için nelerin gerektiğini hiçbir ülke bilmiyor.
Bu raporda, bir üniversitenin mevcut kaynakları ile seçkin bir üniversite grubuna girme yolunda ilerleme, değerlendirme ve kıyaslama sağlayacak materyallerin bazılarını kısaca gözden geçireceğiz.
Dünya Ligi Üniversitesi Olmak!
Philip Altbach ve Jamil Salmi, 2011 tarihli “Akademik Mükemmelliğe Giden Yol” kitabında üç temel özellikle “Dünya Çapında Üniversite”yi tanımlıyor:
  1. Üstün beceri ve yeteneklerle donatılmış akademik kadro ve öğrenci profili 
  2. Zengin bir öğrenim ortamı yaratmak ve ileri araştırmaları desteklemek için bol miktarda kaynak
  3. Öngörüyü, stratejik vizyonu ve bürokrasiye aşırı bağımlılık olmaksızın değişiklik yapma esnekliğini destekleyen uygun yönetim prosedürleri.
Dünya çapında olmak için bir üniversite ayrıca, uluslararası bir eğitim-öğretim kadrosu ve öğrenci profili ve küresel bazda istihdam edilebilir mezunlar vermelidir. Benzer şekilde, bir üniversite dünya çapında tanınmak için iş ve uluslararası kaynaklardan gelen yatırımları cezbetmeli ve araştırma ve teknolojik atılımların bulgularından yararlanmalıdır.
Dünya çapında üniversitelerin, bir dizi disiplin ve alanda bilgi yaratma ve yayma, ulusal ve uluslararası seviyede seçkin bir eğitim sunması beklenir.
Tabii ki, hiçbir üniversite kendini “dünya çapında bir üniversite” olarak ilan edemez. Bir üniversitenin akademik statüsü resmi sıralamalarda sunulan objektif değerlendirmeler ile teyit edilmelidir. Bunlara örnek olarak Şanghay Jiao Tong Üniversitesi tarafından hazırlanan “Dünya Üniversitelerinin Akademik Sıralaması” verilebilir; bu sıralamada 3000 üniversite analiz edilir ve ilk 500 sıralamaya tabi tutulur. Benzer şekilde US News tarafından her yıl “En İyi Global Üniversiteler” adı altında atıf etkisi, itibar ve diğer parametrelere göre en yüksek performans gösteren 750 üniversite sıralanır. Bu iki sıralama “Web of Science” verileriyle desteklenmektedir. Ayrıca 2015’ten bu yana, Thomson Reuters’in eski IP & Science şirketi olan Clarify Analytics tarafından üretilen verilere dayalı bir akademik sıralama da bulunmaktadır.
dunya-capinda
Kaynak: The Road to Academic Excellence, World Bank, 2011.
Reuters’in sıralaması, yayınlanan araştırma ve patentleme faaliyetinin etkilerini göz önüne alarak  dünyanın en yenilikçi 100 üniversitesini ve Avrupa’daki ve Asya’daki en yenilikçi üniversiteleri sıralamaktadır.
Bir üniversite, “dünya üniversite” ligine dahil olduğunda bir dizi avantaj elde edebilir: uluslararası tanınırlık, nüfuz, maddi kazanç, yetenek cezbetme, daha fazla kaynak,  beğeni vb. Böylece, bu statüsü sürdürülebilir olacaktır.
Kaynak: World-Class Universities: Choosing the Path, Marking the Progress, Web of Science, Clarivate Analytics, January 2017.